Details of Primer Pair 'ABC07506_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07506_L01R01403Nils Rostoks2004-01-26 ABC07506_L01 TAAGGCGGGTCCATGGAGAA 1690 20 Nils Rostoks 2004-01-26 Illumina
ABC07506_R01 TATTGTTCTGGTGGGGCGCT 2092 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07506_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes