Details of Primer Pair 'ABC07525_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07525_L01R01455Nils Rostoks2004-01-26 ABC07525_L01 CATCCTCTACAGCGGGTGCC 437 20 Nils Rostoks 2004-01-26 Illumina
ABC07525_R01 AGGTCATTCCCGTGCGAGAC 891 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07525_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes