Details of Primer Pair 'ABC07565_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07565_L01R01523Nils Rostoks2004-01-26 ABC07565_L01 CTACCGGCCAAACCACAAGG 740 20 Nils Rostoks 2004-01-26 Illumina
ABC07565_R01 GGTCCAAGTTGGTGCCACAG 1262 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07565_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes