Details of Primer Pair 'ABC07566_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07566_L01R01421Nils Rostoks2004-01-26 ABC07566_L01 TGGTCCCCGTGATGTGAAAA 1239 20 Nils Rostoks 2004-01-26 Illumina
ABC07566_R01 TGGTTGCACAAACATGGCCT 1659 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07566_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes