Details of Primer Pair 'ABC07611_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07611_L01R01417Nils Rostoks2004-01-26 ABC07611_L01 GAGAAGCCAACAGCCGAGGA 794 20 Nils Rostoks 2004-01-26 Illumina
ABC07611_R01 CTGCCAAGGTGCATCCATCA 1210 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07611_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes