Details of Primer Pair 'ABC07631_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07631_L01R01435Nils Rostoks2004-01-26 ABC07631_L01 AAGAAGGCAACTGAGGGGGC 1141 20 Nils Rostoks 2004-01-26 Illumina
ABC07631_R01 AATTCAGAGGCCAGCAACCG 1575 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07631_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes