Details of Primer Pair 'ABC07681_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07681_L01R01565Nils Rostoks2004-01-26 ABC07681_L01 TGAGCGTGGCTTGTTTGGAA 1085 20 Nils Rostoks 2004-01-26 Illumina
ABC07681_R01 GTACCACCCTGCGTGCTGTG 1649 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07681_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes