Details of Primer Pair 'ABC07722_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07722_L01R01453Nils Rostoks2004-01-26 ABC07722_L01 GCCCTCGACCTGGACCTCTT 498 20 Nils Rostoks 2004-01-26 Illumina
ABC07722_R01 GGGCTCCTCGGTCTGTCTCA 950 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07722_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes