Details of Primer Pair 'ABC07733_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07733_L01R01522Nils Rostoks2004-01-26 ABC07733_L01 TGTGTTGTCGGCGAACCAGT 841 20 Nils Rostoks 2004-01-26 Illumina
ABC07733_R01 CAGCGAAAGTTACAGGGGCG 1362 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07733_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes