Details of Primer Pair 'ABC07753_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07753_L01R01545Nils Rostoks2004-01-26 ABC07753_L01 CTTGCTAAAGGCACCGGCAT 363 20 Nils Rostoks 2004-01-26 Illumina
ABC07753_R01 TGCGCAAACCACACCATACA 907 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07753_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes