Details of Primer Pair 'ABC07759_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07759_L01R01208Nils Rostoks2005-03-17 ABC07759_L01 GCAACTCCTCATCATCTCAGG 1246 21 Nils Rostoks 2005-03-17 Invitrogen
ABC07759_R01 CAACAGCCAGAAGGTCTACG 1038 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC07759_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB