Details of Primer Pair 'ABC07825_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07825_L01R01626Nils Rostoks2004-05-27 ABC07825_L01 GTGGGGTACGAGGCAGATGG 443 20 Nils Rostoks 2004-05-27 Qiagen
ABC07825_R01 TCGACGGTGACGATGTGGAT 1069 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC07825_L01R01'

2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined