Details of Primer Pair 'ABC07893_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07893_L01R01404Nils Rostoks2004-01-26 ABC07893_L01 AGCCAACCCGTGGAGGATTT 853 20 Nils Rostoks 2004-01-26 Illumina
ABC07893_R01 ACATGGTGTCCTTCCGCACC 1256 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07893_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes