Details of Primer Pair 'ABC07938_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07938_L01R01475Nils Rostoks2004-01-26 ABC07938_L01 GCCAGCGGCTACCTTTTCCT 2062 20 Nils Rostoks 2004-01-26 Illumina
ABC07938_R01 CAATCATGCCATTCCACCCTC 2536 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07938_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes