Details of Primer Pair 'ABC07970_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07970_L01R01160Nils Rostoks and Joanne Russel2005-03-17 ABC07970_L01 TGCATTGGGAGTGCTAGG 730 18 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen
ABC07970_R01 TGCAAGAAGCCAAGAATACC 570 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen

Comment History of 'ABC07970_L01R01'

No comments recorded for ABC07970_L01R01.