Details of Primer Pair 'ABC08004_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08004_L01R01687Nils Rostoks2004-05-27 ABC08004_L01 CCCCCAGGACCACGCACTAG 783 20 Nils Rostoks 2004-05-27 Qiagen
ABC08004_R01 CACGGTGGATGACAGCGGTAAC 96 22 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC08004_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined