Details of Primer Pair 'ABC08038_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08038_L01R01403Nils Rostoks2004-01-26 ABC08038_L01 CAATCAAAGCTCGGGCTGCT 1467 20 Nils Rostoks 2004-01-26 Illumina
ABC08038_R01 CGTGCGAATACCCGTGATGA 1869 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08038_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes