Details of Primer Pair 'ABC08085_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08085_L01R01553Nils Rostoks2004-01-26 ABC08085_L01 GGGAAGGCATCATCCAGGTG 628 20 Nils Rostoks 2004-01-26 Illumina
ABC08085_R01 TAACGACGCCGGAACTCACA 1180 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08085_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes