Details of Primer Pair 'ABC08151_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08151_L01R01419Nils Rostoks2004-01-26 ABC08151_L01 TGAAGGACCTGGAGCCAAGC 1038 20 Nils Rostoks 2004-01-26 Illumina
ABC08151_R01 TTGTAAAAGCGCCACGACGA 1456 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08151_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes