Details of Primer Pair 'ABC08184_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08184_L01R01583Nils Rostoks2004-01-26 ABC08184_L01 AGGGCTACGAGGCCAAGGAC 371 20 Nils Rostoks 2004-01-26 Illumina
ABC08184_R01 AAGGGAGGGGTCAGGAATGC 953 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08184_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes