Details of Primer Pair 'ABC08208_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08208_L01R01466Nils Rostoks2004-01-26 ABC08208_L01 CGGCACCTCCTGGTTCATCT 749 20 Nils Rostoks 2004-01-26 Illumina
ABC08208_R01 GCACCAGCTTGTGGCAAATG 1214 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08208_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes