Details of Primer Pair 'ABC08225_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08225_L01R01429Nils Rostoks2004-01-26 ABC08225_L01 TGGCGAATCTCACGGAACAA 1625 20 Nils Rostoks 2004-01-26 Illumina
ABC08225_R01 CCCAGCAGCAGCGAAAAGAT 2053 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08225_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes