Details of Primer Pair 'ABC08238_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08238_L01R01191Nils Rostoks2005-03-17 ABC08238_L01 CAGCAGCAGATCAAATCAGG 380 20 Nils Rostoks 2005-03-17 Invitrogen
ABC08238_R01 TACTCTTCTCTTGGCCTTGG 571 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC08238_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB