Details of Primer Pair 'ABC08246_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08246_L01R01547Nils Rostoks2004-01-26 ABC08246_L01 GACCTCTTCCAGCCCGACAA 883 20 Nils Rostoks 2004-01-26 Illumina
ABC08246_R01 TTAGAGTGGTCGCCAAGCCC 1429 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08246_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes