Details of Primer Pair 'ABC08260_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08260_L01R01435Nils Rostoks2004-01-26 ABC08260_L01 GAGGCCCTGGAAAAACCCAC 541 20 Nils Rostoks 2004-01-26 Illumina
ABC08260_R01 GGCCAGGAAGAGCCCAATCT 975 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08260_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes