Details of Primer Pair 'ABC08308_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08308_L01R01403Nils Rostoks2004-01-26 ABC08308_L01 AGCTGTTGACCCTGGCCTTG 1533 20 Nils Rostoks 2004-01-26 Illumina
ABC08308_R01 TGTGCGTATCGCAACAGGAA 1935 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08308_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes