Details of Primer Pair 'ABC08327_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08327_L01R01401Nils Rostoks2004-01-26 ABC08327_L01 TGTTGCCAACCCAGCTACGA 161 20 Nils Rostoks 2004-01-26 Illumina
ABC08327_R01 TGCCACTCAACAATCTGGTGC 561 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08327_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes