Details of Primer Pair 'ABC08396_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08396_L01R01482Nils Rostoks2004-01-26 ABC08396_L01 CCCTATGGCGCTCAAGCAGT 148 20 Nils Rostoks 2004-01-26 Illumina
ABC08396_R01 ACAGCAGCAGGCCCTGAATC 629 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08396_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes