Details of Primer Pair 'ABC08447_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08447_L01R01177Nils Rostoks2005-03-17 ABC08447_L01 AAATTTGTATTGGCTGGTTCC 1998 21 Nils Rostoks 2005-03-17 Invitrogen
ABC08447_R01 ACAAAAGCAAACCCTAGACC 2175 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC08447_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB