Details of Primer Pair 'ABC08537_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08537_L01R01520Nils Rostoks2004-05-27 ABC08537_L01 CACTCAGCAAGCATCAACACG 533 21 Nils Rostoks 2004-05-27 Qiagen
ABC08537_R01 GAGGCGAGAATCCCCAAACC 13 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC08537_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined