Details of Primer Pair 'ABC08641_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08641_L01R01425Nils Rostoks2004-01-26 ABC08641_L01 CCATACGCTGTCCCAATGGA 1251 20 Nils Rostoks 2004-01-26 Illumina
ABC08641_R01 GGGGCCCTAGACAGGGAAGA 1675 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08641_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes