Details of Primer Pair 'ABC08769_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08769_L01R01471Nils Rostoks2004-01-26 ABC08769_L01 CCGGCAGTTGGACAAAGGAA 346 20 Nils Rostoks 2004-01-26 Illumina
ABC08769_R01 ACGGTGGTGCCTAAAGCCCT 816 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08769_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes