Details of Primer Pair 'ABC08788_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08788_L01R01451Nils Rostoks2004-01-26 ABC08788_L01 GAGGATGGGGAGGTAACGGC 563 20 Nils Rostoks 2004-01-26 Illumina
ABC08788_R01 GTCTCCGAAGGGCAGTCCAA 1013 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08788_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes