Details of Primer Pair 'ABC08857_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08857_L01R01533Nils Rostoks2004-01-26 ABC08857_L01 TTCACCAGAAGCCCTCGTCC 172 20 Nils Rostoks 2004-01-26 Illumina
ABC08857_R01 TGAAGATGGAGAGCGGAGGG 704 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08857_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes