Details of Primer Pair 'ABC08896_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC08896_L01R01402Nils Rostoks2004-01-26 ABC08896_L01 CGTCAGAGGTCGGTGCTTGA 812 20 Nils Rostoks 2004-01-26 Illumina
ABC08896_R01 GGAAAGACTGGGCGTGTTGC 1213 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC08896_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes