Details of Primer Pair 'ABC09041_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09041_L01R01164Nils Rostoks2005-03-17 ABC09041_L01 CATGTCAGTGGGGTTCTAGC 177 20 Nils Rostoks 2005-03-17 Invitrogen
ABC09041_R01 TCTACTTGGACCTGCTGACC 341 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC09041_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB