Details of Primer Pair 'ABC09099_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09099_L01R01481Nils Rostoks2004-01-26 ABC09099_L01 ATTCACGCATCGTGCTCTCG 902 20 Nils Rostoks 2004-01-26 Illumina
ABC09099_R01 CGGGGTTTCAAGTCGACCAC 1382 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09099_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes