Details of Primer Pair 'ABC09144_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09144_L01R01419Nils Rostoks2004-01-26 ABC09144_L01 GCCCCGGTTAACAGTGCAAG 1487 20 Nils Rostoks 2004-01-26 Illumina
ABC09144_R01 CATGGGGACCCTCCCAACTT 1905 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09144_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes