Details of Primer Pair 'ABC09154_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09154_L01R01497Nils Rostoks2004-01-26 ABC09154_L01 TAACTTGCCAGCTCGGAGGC 747 20 Nils Rostoks 2004-01-26 Illumina
ABC09154_R01 CAGCCCAACTATGCCCGAAG 1243 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09154_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes