Details of Primer Pair 'ABC09163_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09163_L01R01462Nils Rostoks2004-01-26 ABC09163_L01 TCTGGGCTTCATGGTGTGGA 397 20 Nils Rostoks 2004-01-26 Illumina
ABC09163_R01 TGAGACCAGGCTTCCTTGGG 858 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09163_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes