Details of Primer Pair 'ABC09278_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09278_L01R01528Nils Rostoks2004-01-26 ABC09278_L01 CGGCAGCATAAATACCCCCA 835 20 Nils Rostoks 2004-01-26 Illumina
ABC09278_R01 GCTTGAGCTCATCTGCCGGT 1362 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09278_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes