Details of Primer Pair 'ABC09281_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09281_L01R01551Nils Rostoks2004-01-26 ABC09281_L01 CCTGCCATCTCACTCTCGCA 520 20 Nils Rostoks 2004-01-26 Illumina
ABC09281_R01 GGCGACACATATTGGGGCTC 1070 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09281_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes