Details of Primer Pair 'ABC09300_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09300_L01R01477Nils Rostoks2004-01-26 ABC09300_L01 GACTGAACGGAGGCAGCCAT 1034 20 Nils Rostoks 2004-01-26 Illumina
ABC09300_R01 ATGCAAATGCAATCGAGCCA 1510 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09300_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes