Details of Primer Pair 'ABC09320_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09320_L01R01434Nils Rostoks2004-01-26 ABC09320_L01 TGGTCGACGAGATCGAGCAG 901 20 Nils Rostoks 2004-01-26 Illumina
ABC09320_R01 ACTTAGATGCGCTGCCGCTT 1334 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09320_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes