Details of Primer Pair 'ABC09365_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09365_L01R01464Nils Rostoks2004-01-26 ABC09365_L01 TGGAAGACGCTAAGGGCTGC 1350 20 Nils Rostoks 2004-01-26 Illumina
ABC09365_R01 AAACGCAGTTCAAGCTGCCA 1813 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09365_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes