Details of Primer Pair 'ABC09402_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09402_L01R01463Nils Rostoks2004-01-26 ABC09402_L01 TCCCAGCGTCACCAGATTCA 319 20 Nils Rostoks 2004-01-26 Illumina
ABC09402_R01 CATCATCACGCCCAGCAGTC 781 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09402_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes