Details of Primer Pair 'ABC09432_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09432_L01R01411Nils Rostoks2004-01-26 ABC09432_L01 GCAAGGGGCATTCATCCATC 1485 20 Nils Rostoks 2004-01-26 Illumina
ABC09432_R01 TTGGGTGCCCACAGAGAACA 1895 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09432_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes