Details of Primer Pair 'ABC09443_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09443_L01R01473Nils Rostoks2004-01-26 ABC09443_L01 CGGGGATTTGGTTTTGTCCA 313 20 Nils Rostoks 2004-01-26 Illumina
ABC09443_R01 CACGGTCCACACAAAAGGGA 785 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09443_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes