Details of Primer Pair 'ABC09559_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09559_L01R01425Nils Rostoks2004-01-26 ABC09559_L01 CAGCGATGATGATTGACGCC 1238 20 Nils Rostoks 2004-01-26 Illumina
ABC09559_R01 TGAACCAACAAACCACCCCA 1662 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09559_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes