Details of Primer Pair 'ABC09662_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC09662_L01R01423Nils Rostoks2004-01-26 ABC09662_L01 CTCCATGCTCTGCCACCTCA 972 20 Nils Rostoks 2004-01-26 Illumina
ABC09662_R01 CGCACTGCCTGCTGTTCCT 1394 19 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC09662_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes